Transcript: Human NM_001161662.2

Homo sapiens WW and C2 domain containing 1 (WWC1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
WWC1 (23286)
Length:
7151
CDS:
509..3865

Additional Resources:

NCBI RefSeq record:
NM_001161662.2
NBCI Gene record:
WWC1 (23286)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001161662.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243362 TCTCTGCAGATGACGTCTAAT pLKO_005 3846 CDS 100% 13.200 18.480 N WWC1 n/a
2 TRCN0000243363 TCAGATTGCGCCTTCGATATG pLKO_005 1413 CDS 100% 10.800 15.120 N WWC1 n/a
3 TRCN0000243359 CCTTCACCAGAAGACCTTAAG pLKO_005 2722 CDS 100% 10.800 8.640 N WWC1 n/a
4 TRCN0000243360 TTGTCACAGTACAGCTAATTT pLKO_005 4298 3UTR 100% 15.000 10.500 N WWC1 n/a
5 TRCN0000243361 CAACCTTCTCAGCTACAAATA pLKO_005 2851 CDS 100% 13.200 9.240 N WWC1 n/a
6 TRCN0000167467 GAGGTCTTACTGCAATAAGAA pLKO.1 4235 3UTR 100% 0.563 0.394 N WWC1 n/a
7 TRCN0000177135 GAGATCCTGAAAGCTGAAATT pLKO.1 980 CDS 100% 13.200 7.920 N Wwc1 n/a
8 TRCN0000341228 GAGATCCTGAAAGCTGAAATT pLKO_005 980 CDS 100% 13.200 7.920 N Wwc1 n/a
9 TRCN0000172906 GACGGCAAGGTCTACTACATA pLKO.1 563 CDS 100% 5.625 3.375 N WWC1 n/a
10 TRCN0000176876 GATTACTTCATAGACCACAAT pLKO.1 713 CDS 100% 4.950 3.465 N Wwc1 n/a
11 TRCN0000341160 GATTACTTCATAGACCACAAT pLKO_005 713 CDS 100% 4.950 3.465 N Wwc1 n/a
12 TRCN0000182717 CCAGCATTAAAGGTGGACAGA pLKO.1 3155 CDS 100% 2.640 1.848 N Wwc1 n/a
13 TRCN0000436416 AGAAGGAGGAGCTGCTGAAAC pLKO_005 1545 CDS 100% 10.800 5.400 Y RPL35 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001161662.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.