Transcript: Mouse NM_001161832.1

Mus musculus brachyury 2 (T2), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
T2 (21331)
Length:
1755
CDS:
1..1182

Additional Resources:

NCBI RefSeq record:
NM_001161832.1
NBCI Gene record:
T2 (21331)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001161832.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246585 GTCGATACTGGGTGAACAATG pLKO_005 1148 CDS 100% 10.800 15.120 N T2 n/a
2 TRCN0000190559 GAACGTACACAGGCAGATGTT pLKO.1 811 CDS 100% 4.950 3.465 N T2 n/a
3 TRCN0000192963 GATTACATGGTCCCAAGAGAA pLKO.1 793 CDS 100% 4.950 3.465 N T2 n/a
4 TRCN0000246587 ATGGTCCCAAGAGAACGTACA pLKO_005 799 CDS 100% 4.050 2.835 N T2 n/a
5 TRCN0000246586 GTTCCACCAAGAGAACGTACA pLKO_005 829 CDS 100% 4.050 2.835 N T2 n/a
6 TRCN0000190641 CAGAAAGTCCACAGAGACGTT pLKO.1 953 CDS 100% 2.640 1.848 N T2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001161832.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.