Transcript: Human NM_001162422.1

Homo sapiens ETS proto-oncogene 1, transcription factor (ETS1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
ETS1 (2113)
Length:
4594
CDS:
317..994

Additional Resources:

NCBI RefSeq record:
NM_001162422.1
NBCI Gene record:
ETS1 (2113)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001162422.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231918 GACCGTGCTGACCTCAATAAG pLKO_005 596 CDS 100% 13.200 18.480 N ETS1 n/a
2 TRCN0000231919 CCAAATTCATGGGACTTATAT pLKO_005 1753 3UTR 100% 15.000 10.500 N ETS1 n/a
3 TRCN0000005591 CTGGAATTACTCACTGATAAA pLKO.1 692 CDS 100% 13.200 9.240 N ETS1 n/a
4 TRCN0000005588 CCCAGAATTATCAGGAACATA pLKO.1 2962 3UTR 100% 5.625 3.938 N ETS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001162422.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.