Transcript: Mouse NM_001162521.1

Mus musculus deoxyguanosine kinase (Dguok), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Dguok (27369)
Length:
1010
CDS:
81..791

Additional Resources:

NCBI RefSeq record:
NM_001162521.1
NBCI Gene record:
Dguok (27369)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001162521.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006077 AGCACGATGGTCCTACACATT pLKO.1 389 CDS 100% 4.950 3.960 N DGUOK n/a
2 TRCN0000338412 AGCACGATGGTCCTACACATT pLKO_005 389 CDS 100% 4.950 3.960 N DGUOK n/a
3 TRCN0000025534 CGTCTTGGAAACTTGCTAGAA pLKO.1 351 CDS 100% 4.950 3.960 N Dguok n/a
4 TRCN0000278723 CGTCTTGGAAACTTGCTAGAA pLKO_005 351 CDS 100% 4.950 3.960 N Dguok n/a
5 TRCN0000025538 GCACTTCCAAACGTCTTGGAA pLKO.1 340 CDS 100% 0.300 0.240 N Dguok n/a
6 TRCN0000278603 GCACTTCCAAACGTCTTGGAA pLKO_005 340 CDS 100% 0.300 0.240 N Dguok n/a
7 TRCN0000025536 GCACGAAGACTGGTTTATTAA pLKO.1 755 CDS 100% 15.000 10.500 N Dguok n/a
8 TRCN0000278602 GCACGAAGACTGGTTTATTAA pLKO_005 755 CDS 100% 15.000 10.500 N Dguok n/a
9 TRCN0000025537 GAACACCTTTATGAGGAACTT pLKO.1 790 CDS 100% 4.950 3.465 N Dguok n/a
10 TRCN0000278667 GAACACCTTTATGAGGAACTT pLKO_005 790 CDS 100% 4.950 3.465 N Dguok n/a
11 TRCN0000025535 GCTTCATCTATCTCCAGGCTT pLKO.1 643 CDS 100% 2.640 1.848 N Dguok n/a
12 TRCN0000278666 GCTTCATCTATCTCCAGGCTT pLKO_005 643 CDS 100% 2.640 1.848 N Dguok n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001162521.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.