Transcript: Mouse NM_001163019.1

Mus musculus RIKEN cDNA A430005L14 gene (A430005L14Rik), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
A430005L14Rik (97159)
Length:
995
CDS:
72..650

Additional Resources:

NCBI RefSeq record:
NM_001163019.1
NBCI Gene record:
A430005L14Rik (97159)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163019.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283162 TTGCAGCCGGTGTCAAGATTC pLKO_005 664 3UTR 100% 10.800 8.640 N A430005L14Rik n/a
2 TRCN0000190601 GCCGGTGTCAAGATTCTGTAT pLKO.1 669 3UTR 100% 4.950 3.465 N A430005L14Rik n/a
3 TRCN0000190458 GCTTCCTCATCACACAAAGCT pLKO.1 87 CDS 100% 3.000 2.100 N A430005L14Rik n/a
4 TRCN0000264759 CACCAGCCTCTTCATCTTATC pLKO_005 556 CDS 100% 10.800 6.480 N A430005L14Rik n/a
5 TRCN0000264761 TGACCCTAAGAGTGACATTTC pLKO_005 179 CDS 100% 10.800 6.480 N A430005L14Rik n/a
6 TRCN0000216879 GACCCTAAGAGTGACATTTCT pLKO.1 180 CDS 100% 5.625 3.375 N A430005L14Rik n/a
7 TRCN0000264760 CACCTTGTGAAGGCAGAATTA pLKO_005 150 CDS 100% 13.200 6.600 Y A430005L14Rik n/a
8 TRCN0000201540 CTTCGGGAATGTCGAGCTTAT pLKO.1 524 CDS 100% 10.800 5.400 Y A430005L14Rik n/a
9 TRCN0000264762 CTTCGGGAATGTCGAGCTTAT pLKO_005 524 CDS 100% 10.800 5.400 Y A430005L14Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163019.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.