Transcript: Mouse NM_001163531.1

Mus musculus transmembrane protein 175 (Tmem175), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Tmem175 (72392)
Length:
2963
CDS:
202..1698

Additional Resources:

NCBI RefSeq record:
NM_001163531.1
NBCI Gene record:
Tmem175 (72392)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163531.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000181423 CCATTCCTGTACCAGTTGTTA pLKO.1 2197 3UTR 100% 5.625 7.875 N Tmem175 n/a
2 TRCN0000178702 CCAGTTGTTAGACAAAGACAA pLKO.1 2208 3UTR 100% 4.950 3.465 N Tmem175 n/a
3 TRCN0000182512 CCCATTCCTGTACCAGTTGTT pLKO.1 2196 3UTR 100% 4.950 3.465 N Tmem175 n/a
4 TRCN0000200392 GCTGCATCAGACAGAAACACT pLKO.1 1383 CDS 100% 3.000 2.100 N Tmem175 n/a
5 TRCN0000181599 GCTTTCATGTTTGCCAAGCTT pLKO.1 1438 CDS 100% 3.000 2.100 N Tmem175 n/a
6 TRCN0000198414 GATCACATTCAGGTAGTGATA pLKO.1 2285 3UTR 100% 0.495 0.347 N Tmem175 n/a
7 TRCN0000182029 CCAAGGATGTGCAAGAGAAAT pLKO.1 1052 CDS 100% 13.200 7.920 N Tmem175 n/a
8 TRCN0000182790 CCTGGCCTGTATGATGACTAT pLKO.1 528 CDS 100% 4.950 2.970 N Tmem175 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163531.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.