Transcript: Mouse NM_001163574.1

Mus musculus tight junction protein 1 (Tjp1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Tjp1 (21872)
Length:
6891
CDS:
409..5466

Additional Resources:

NCBI RefSeq record:
NM_001163574.1
NBCI Gene record:
Tjp1 (21872)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163574.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091619 CCGAAGATATTGTTCGATCAA pLKO.1 4175 CDS 100% 4.950 6.930 N Tjp1 n/a
2 TRCN0000331607 CCGAAGATATTGTTCGATCAA pLKO_005 4175 CDS 100% 4.950 6.930 N Tjp1 n/a
3 TRCN0000091621 CCGCGAAGTTATGAGCAAGTT pLKO.1 3751 CDS 100% 4.950 6.930 N Tjp1 n/a
4 TRCN0000302391 CCGCGAAGTTATGAGCAAGTT pLKO_005 3751 CDS 100% 4.950 6.930 N Tjp1 n/a
5 TRCN0000091620 CGCCGCATTGTAGAATCAGAT pLKO.1 1930 CDS 100% 4.950 6.930 N Tjp1 n/a
6 TRCN0000302392 CGCCGCATTGTAGAATCAGAT pLKO_005 1930 CDS 100% 4.950 6.930 N Tjp1 n/a
7 TRCN0000091618 CGTGGATTGAACTTACTAAAT pLKO.1 5503 3UTR 100% 13.200 9.240 N Tjp1 n/a
8 TRCN0000302389 CGTGGATTGAACTTACTAAAT pLKO_005 5503 3UTR 100% 13.200 9.240 N Tjp1 n/a
9 TRCN0000091622 CGGCCATTTGAACGCAAATTT pLKO.1 4768 CDS 100% 1.500 1.050 N Tjp1 n/a
10 TRCN0000302326 CGGCCATTTGAACGCAAATTT pLKO_005 4768 CDS 100% 1.500 1.050 N Tjp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163574.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.