Transcript: Human NM_001163677.1

Homo sapiens potassium calcium-activated channel subfamily M regulatory beta subunit 3 (KCNMB3), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
KCNMB3 (27094)
Length:
1123
CDS:
341..862

Additional Resources:

NCBI RefSeq record:
NM_001163677.1
NBCI Gene record:
KCNMB3 (27094)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001163677.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044369 GCTCGGAACAACCATTCTAAA pLKO.1 559 CDS 100% 13.200 10.560 N KCNMB3 n/a
2 TRCN0000044372 GATGGGCTTCTCAGTCCTAAT pLKO.1 529 CDS 100% 10.800 8.640 N KCNMB3 n/a
3 TRCN0000428981 GAAAGCTCTCCTACATTATAA pLKO_005 745 CDS 100% 15.000 10.500 N KCNMB3 n/a
4 TRCN0000436767 ACCCGTGTCTTCAGGTGTTTG pLKO_005 702 CDS 100% 10.800 7.560 N KCNMB3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163677.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.