Transcript: Mouse NM_001163709.1

Mus musculus brain protein I3 (Bri3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Bri3 (55950)
Length:
847
CDS:
50..415

Additional Resources:

NCBI RefSeq record:
NM_001163709.1
NBCI Gene record:
Bri3 (55950)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163709.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348681 GGGTCTATAACATCCACAGTC pLKO_005 201 CDS 100% 4.050 5.670 N Bri3 n/a
2 TRCN0000313656 CCCGGGTCTATAACATCCACA pLKO_005 198 CDS 100% 2.640 3.696 N Bri3 n/a
3 TRCN0000124515 CGGGTCTATAACATCCACAGT pLKO.1 200 CDS 100% 2.640 3.696 N Bri3 n/a
4 TRCN0000124517 TCTATAACATCCACAGTCGAA pLKO.1 204 CDS 100% 2.640 3.696 N Bri3 n/a
5 TRCN0000375389 ACTTTGAGAATGGTGAGAAAT pLKO_005 620 3UTR 100% 13.200 9.240 N Bri3 n/a
6 TRCN0000124518 CCAACTGTGGAGCGGTCTTTA pLKO.1 390 CDS 100% 13.200 9.240 N Bri3 n/a
7 TRCN0000317308 CCAACTGTGGAGCGGTCTTTA pLKO_005 390 CDS 100% 13.200 9.240 N Bri3 n/a
8 TRCN0000124514 CATACCATTGTGTAGCTTGTT pLKO.1 663 3UTR 100% 4.950 3.465 N Bri3 n/a
9 TRCN0000348680 TTGCACTGAGGAAGCGAAGAT pLKO_005 366 CDS 100% 4.950 3.465 N Bri3 n/a
10 TRCN0000375390 GTATCCTGCCAACTCCATCGT pLKO_005 235 CDS 100% 2.640 1.848 N Bri3 n/a
11 TRCN0000349983 TTGGTGTCCTGGAGTACTGCT pLKO_005 285 CDS 100% 2.640 1.848 N Bri3 n/a
12 TRCN0000349984 GGGTAACGTGCTGCTTCTATT pLKO_005 586 3UTR 100% 13.200 7.920 N Bri3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163709.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.