Transcript: Mouse NM_001163768.1

Mus musculus Tctex1 domain containing 1 (Tctex1d1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Tctex1d1 (67344)
Length:
1904
CDS:
304..654

Additional Resources:

NCBI RefSeq record:
NM_001163768.1
NBCI Gene record:
Tctex1d1 (67344)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163768.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427756 ATTAGTGATTCCGAGATATAA pLKO_005 474 CDS 100% 15.000 21.000 N Tctex1d1 n/a
2 TRCN0000427867 GTCAGTGCCATTCACATAAAT pLKO_005 848 3UTR 100% 15.000 12.000 N Tctex1d1 n/a
3 TRCN0000431375 GATGACCAGAGCATAGTTATT pLKO_005 526 CDS 100% 13.200 10.560 N Tctex1d1 n/a
4 TRCN0000183152 GATGTACTAACTACCTACCTA pLKO.1 373 CDS 100% 3.000 2.400 N Tctex1d1 n/a
5 TRCN0000429109 GCAACATACTCTGGATATATA pLKO_005 978 3UTR 100% 15.000 10.500 N Tctex1d1 n/a
6 TRCN0000195946 CGTGGCCACTGTCAATCATAT pLKO.1 345 CDS 100% 13.200 9.240 N Tctex1d1 n/a
7 TRCN0000421645 AGATGCCTCTGGAATCCTAAA pLKO_005 553 CDS 100% 10.800 7.560 N Tctex1d1 n/a
8 TRCN0000183082 CAAATGTCTATGCAGTTTACT pLKO.1 626 CDS 100% 5.625 3.938 N Tctex1d1 n/a
9 TRCN0000179501 GAAAGTGGTCCTTGTGTGTTA pLKO.1 657 3UTR 100% 4.950 3.465 N Tctex1d1 n/a
10 TRCN0000419142 AGGCCTTAGTACTGCATATAA pLKO_005 1061 3UTR 100% 15.000 9.000 N Tctex1d1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163768.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.