Transcript: Mouse NM_001164147.1

Mus musculus transcription factor 3 (Tcf3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Tcf3 (21423)
Length:
3320
CDS:
392..2353

Additional Resources:

NCBI RefSeq record:
NM_001164147.1
NBCI Gene record:
Tcf3 (21423)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164147.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233412 TTTGACCCTAGCCGGACATAC pLKO_005 599 CDS 100% 10.800 15.120 N Tcf3 n/a
2 TRCN0000086614 CCAGCAATAATTTCTCACCTA pLKO.1 1422 CDS 100% 2.640 2.112 N Tcf3 n/a
3 TRCN0000086617 CCGGATCACTCCAGCAATAAT pLKO.1 1412 CDS 100% 15.000 10.500 N Tcf3 n/a
4 TRCN0000233414 CCCGGATCACTCCAGCAATAA pLKO_005 1411 CDS 100% 13.200 9.240 N Tcf3 n/a
5 TRCN0000233413 TGCATGGATCTGAGGTTAATG pLKO_005 1218 CDS 100% 13.200 9.240 N Tcf3 n/a
6 TRCN0000233416 GCACATCGTGCCTAAGCATTT pLKO_005 2690 3UTR 100% 10.800 7.560 N Tcf3 n/a
7 TRCN0000086615 GCGACATCAATGAGGCCTTTA pLKO.1 2076 CDS 100% 10.800 7.560 N Tcf3 n/a
8 TRCN0000086616 CCTGGACTTCAGCATGATGTT pLKO.1 451 CDS 100% 4.950 3.465 N Tcf3 n/a
9 TRCN0000086613 CCTTAACTATGTAAGACGGAA pLKO.1 2611 3UTR 100% 2.640 1.848 N Tcf3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164147.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.