Transcript: Mouse NM_001164337.1

Mus musculus membrane-associated ring finger (C3HC4) 5 (March5), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
March5 (69104)
Length:
1596
CDS:
326..784

Additional Resources:

NCBI RefSeq record:
NM_001164337.1
NBCI Gene record:
March5 (69104)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164337.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246413 AGCTGGGTCCAGTGGTTTATG pLKO_005 558 CDS 100% 13.200 9.240 N March5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164337.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03448 pDONR223 100% 48.5% 46.7% None (many diffs) n/a
2 ccsbBroad304_03448 pLX_304 0% 48.5% 46.7% V5 (many diffs) n/a
3 TRCN0000465851 CTCTCCCGCTAGCACTGCACCTCA pLX_317 10.3% 48.5% 46.7% V5 (many diffs) n/a
Download CSV