Transcript: Mouse NM_001164355.1

Mus musculus spindle and kinetochore associated complex subunit 1 (Ska1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ska1 (66468)
Length:
2605
CDS:
237..1001

Additional Resources:

NCBI RefSeq record:
NM_001164355.1
NBCI Gene record:
Ska1 (66468)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164355.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197548 CGTACATGAAATCCCGTTTAA pLKO.1 682 CDS 100% 13.200 18.480 N Ska1 n/a
2 TRCN0000182695 GCATAGTATGAGGTCGGGAAA pLKO.1 1578 3UTR 100% 4.050 5.670 N Ska1 n/a
3 TRCN0000176926 GATGAGATCATTGCAGTAAAT pLKO.1 363 CDS 100% 13.200 10.560 N Ska1 n/a
4 TRCN0000340463 GATGAGATCATTGCAGTAAAT pLKO_005 363 CDS 100% 13.200 10.560 N Ska1 n/a
5 TRCN0000340526 CATCGTGGAAGCTGACATAAA pLKO_005 863 CDS 100% 13.200 9.240 N Ska1 n/a
6 TRCN0000197870 GCAGTAAATGAGCTTCTAAAT pLKO.1 375 CDS 100% 13.200 9.240 N Ska1 n/a
7 TRCN0000178480 GCGTACATGAAATCCCGTTTA pLKO.1 681 CDS 100% 10.800 7.560 N Ska1 n/a
8 TRCN0000340464 GCGTACATGAAATCCCGTTTA pLKO_005 681 CDS 100% 10.800 7.560 N Ska1 n/a
9 TRCN0000176501 CTCTGTGAAGAGAAATCTCTA pLKO.1 794 CDS 100% 4.950 3.465 N Ska1 n/a
10 TRCN0000176806 GCCTTGTTTGTTACAGAAGTA pLKO.1 1090 3UTR 100% 4.950 3.465 N Ska1 n/a
11 TRCN0000351063 GCCTTGTTTGTTACAGAAGTA pLKO_005 1090 3UTR 100% 4.950 3.465 N Ska1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164355.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.