Transcript: Mouse NM_001164640.1

Mus musculus apolipoprotein L 7a (Apol7a), transcript variant 2, mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Apol7a (75761)
Length:
2292
CDS:
249..1505

Additional Resources:

NCBI RefSeq record:
NM_001164640.1
NBCI Gene record:
Apol7a (75761)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164640.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105159 GCTGCCTTGCAGGAATCTCTT pLKO.1 399 CDS 100% 4.950 6.930 N Apol7a n/a
2 TRCN0000105156 GATAGTAATACGGAAGATGAA pLKO.1 687 CDS 100% 4.950 6.435 N Apol7a n/a
3 TRCN0000105158 GACACCATTCAGAGATTGCAA pLKO.1 1137 CDS 100% 3.000 2.400 N Apol7a n/a
4 TRCN0000105155 CCACTGTGGATGTTAAGGAAA pLKO.1 2075 3UTR 100% 4.950 3.465 N Apol7a n/a
5 TRCN0000105157 GATAGTGATACAGAAGGTGAA pLKO.1 666 CDS 100% 4.050 2.835 N Apol7a n/a
6 TRCN0000105148 GCCAACCAACAAAGACACAAT pLKO.1 1058 CDS 100% 4.950 2.475 Y Apol7c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164640.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.