Transcript: Mouse NM_001164643.1

Mus musculus trafficking protein particle complex 9 (Trappc9), transcript variant 5, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Trappc9 (76510)
Length:
2833
CDS:
254..1738

Additional Resources:

NCBI RefSeq record:
NM_001164643.1
NBCI Gene record:
Trappc9 (76510)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164643.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246674 GCTCGGCTTCAGTCATTTATC pLKO_005 1002 CDS 100% 13.200 10.560 N Trappc9 n/a
2 TRCN0000246678 CCGAGGACATCATTGACAAAT pLKO_005 1185 CDS 100% 13.200 9.240 N Trappc9 n/a
3 TRCN0000217073 CAAAGAGGCCATCTCCTATTA pLKO.1 1207 CDS 100% 13.200 7.920 N Trappc9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164643.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.