Transcript: Mouse NM_001164655.1

Mus musculus RIKEN cDNA 9530053A07 gene (9530053A07Rik), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
9530053A07Rik (319482)
Length:
7922
CDS:
20..7765

Additional Resources:

NCBI RefSeq record:
NM_001164655.1
NBCI Gene record:
9530053A07Rik (319482)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164655.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076964 CCCGACTTCAAAGTGTTTATA pLKO.1 1472 CDS 100% 15.000 21.000 N 9530053A07Rik n/a
2 TRCN0000076965 GACCCACACTACATGAGTTTA pLKO.1 1376 CDS 100% 13.200 9.240 N 9530053A07Rik n/a
3 TRCN0000076966 CCACACTACATGAGTTTAGAT pLKO.1 1379 CDS 100% 5.625 3.938 N 9530053A07Rik n/a
4 TRCN0000076967 GCCTACAACAGTGCCTACATA pLKO.1 2012 CDS 100% 5.625 3.938 N 9530053A07Rik n/a
5 TRCN0000254022 CTGGCACTGAAGGCATCAAGA pLKO_005 7776 3UTR 100% 4.950 2.475 Y Fcgbp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164655.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.