Transcript: Human NM_001165416.1

Homo sapiens lactate dehydrogenase A (LDHA), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
LDHA (3939)
Length:
2102
CDS:
273..998

Additional Resources:

NCBI RefSeq record:
NM_001165416.1
NBCI Gene record:
LDHA (3939)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001165416.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166152 CACCCAGATTTAGGGACTGAT pLKO.1 915 CDS 100% 4.950 6.930 N LDHA n/a
2 TRCN0000166246 CAATCTGGATTCAGCCCGATT pLKO.1 761 CDS 100% 4.050 5.670 N LDHA n/a
3 TRCN0000026536 CCGAACTGCAAGTTGCTTATT pLKO.1 657 CDS 100% 13.200 10.560 N LDHA n/a
4 TRCN0000162470 CCTGGGATCCAGTGTATAAAT pLKO.1 1530 3UTR 100% 15.000 10.500 N LDHA n/a
5 TRCN0000158762 GCAAGTTGCTTATTGTTTCAA pLKO.1 664 CDS 100% 5.625 3.938 N LDHA n/a
6 TRCN0000164922 GCCTGTGCCATCAGTATCTTA pLKO.1 372 CDS 100% 5.625 3.938 N LDHA n/a
7 TRCN0000158441 CGGAATAAAGGATGATGTCTT pLKO.1 991 CDS 100% 4.950 3.465 N LDHA n/a
8 TRCN0000026537 GATCTGTGATTAAAGCAGTAA pLKO.1 1230 3UTR 100% 4.950 3.465 N LDHA n/a
9 TRCN0000165175 GCAAACTCCAAGCTGGTCATT pLKO.1 531 CDS 100% 4.950 3.465 N LDHA n/a
10 TRCN0000161308 GTTCACCCATTAAGCTGTCAT pLKO.1 810 CDS 100% 4.950 3.465 N LDHA n/a
11 TRCN0000158496 CAGTATCTTAATGAAGGACTT pLKO.1 383 CDS 100% 4.050 2.835 N LDHA n/a
12 TRCN0000026541 CCAAAGATTGTCTCTGGCAAA pLKO.1 495 CDS 100% 4.050 2.835 N LDHA n/a
13 TRCN0000026554 CGTTTGAAGAAGAGTGCAGAT pLKO.1 1091 3UTR 100% 4.050 2.835 N LDHA n/a
14 TRCN0000162267 CAGAATGGAATCTCAGACCTT pLKO.1 1037 3UTR 100% 2.640 1.848 N LDHA n/a
15 TRCN0000166693 CGTCTTAATTTGGTCCAGCGT pLKO.1 588 CDS 100% 0.660 0.462 N LDHA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001165416.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06518 pDONR223 100% 71.9% 71% None (many diffs) n/a
2 ccsbBroad304_06518 pLX_304 0% 71.9% 71% V5 (many diffs) n/a
Download CSV