Transcript: Human NM_001165993.2

Homo sapiens glycerophosphodiester phosphodiesterase domain containing 1 (GDPD1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
GDPD1 (284161)
Length:
1741
CDS:
100..969

Additional Resources:

NCBI RefSeq record:
NM_001165993.2
NBCI Gene record:
GDPD1 (284161)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001165993.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143449 GCTAGAATTGGACTGCCATAT pLKO.1 309 CDS 100% 10.800 15.120 N GDPD1 n/a
2 TRCN0000143254 GCGGTATAATCGAGAACACTT pLKO.1 603 CDS 100% 4.950 6.930 N GDPD1 n/a
3 TRCN0000144619 GAAATCCCAATGCCTTCTATT pLKO.1 781 CDS 100% 13.200 9.240 N GDPD1 n/a
4 TRCN0000139251 CCAGAGAAAGAAGCAGCGATT pLKO.1 192 CDS 100% 4.050 2.430 N GDPD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001165993.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05376 pDONR223 100% 93.7% 88.4% None (many diffs) n/a
2 ccsbBroad304_05376 pLX_304 0% 93.7% 88.4% V5 (many diffs) n/a
Download CSV