Transcript: Human NM_001166003.3

Homo sapiens apolipoprotein B mRNA editing enzyme catalytic subunit 3H (APOBEC3H), transcript variant SV-200, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
APOBEC3H (164668)
Length:
1123
CDS:
108..710

Additional Resources:

NCBI RefSeq record:
NM_001166003.3
NBCI Gene record:
APOBEC3H (164668)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001166003.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051799 CCGCTTACAGTTTAACAACAA pLKO.1 134 CDS 100% 4.950 6.930 N APOBEC3H n/a
2 TRCN0000051800 CGAGCCATAAAGCGACGGCTT pLKO.1 618 CDS 100% 0.720 1.008 N APOBEC3H n/a
3 TRCN0000051802 CCGCCTCAGAAGGCCTTACTA pLKO.1 158 CDS 100% 1.875 1.500 N APOBEC3H n/a
4 TRCN0000434712 GAGAATGACTTAAGAAGTTTG pLKO_005 769 3UTR 100% 10.800 7.560 N APOBEC3H n/a
5 TRCN0000051798 GCCATGCAGAAATTTGCTTTA pLKO.1 265 CDS 100% 10.800 7.560 N APOBEC3H n/a
6 TRCN0000445960 GGCATGTCAGTTGCCTCATAG pLKO_005 848 3UTR 100% 10.800 7.560 N APOBEC3H n/a
7 TRCN0000445571 CATCTGAACCTGGGCATCTTC pLKO_005 408 CDS 100% 4.950 3.465 N APOBEC3H n/a
8 TRCN0000437034 ACGAAACGCAGTGCTACCAAG pLKO_005 313 CDS 100% 4.050 2.835 N APOBEC3H n/a
9 TRCN0000051801 CCACGAGAAACCGCTTTCCTT pLKO.1 557 CDS 100% 3.000 2.100 N APOBEC3H n/a
10 TRCN0000138391 CGCCTGTAATCCTAGCACTTT pLKO.1 1059 3UTR 100% 4.950 2.475 Y DENND6A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166003.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09758 pDONR223 100% 91% 90.5% None 544_545delAT;549_600del n/a
2 ccsbBroad304_09758 pLX_304 0% 91% 90.5% V5 544_545delAT;549_600del n/a
Download CSV