Transcript: Human NM_001166004.2

Homo sapiens apolipoprotein B mRNA editing enzyme catalytic subunit 3H (APOBEC3H), transcript variant SV-154, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
APOBEC3H (164668)
Length:
639
CDS:
128..592

Additional Resources:

NCBI RefSeq record:
NM_001166004.2
NBCI Gene record:
APOBEC3H (164668)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001166004.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051799 CCGCTTACAGTTTAACAACAA pLKO.1 154 CDS 100% 4.950 6.930 N APOBEC3H n/a
2 TRCN0000051802 CCGCCTCAGAAGGCCTTACTA pLKO.1 178 CDS 100% 1.875 1.500 N APOBEC3H n/a
3 TRCN0000051798 GCCATGCAGAAATTTGCTTTA pLKO.1 285 CDS 100% 10.800 7.560 N APOBEC3H n/a
4 TRCN0000445571 CATCTGAACCTGGGCATCTTC pLKO_005 428 CDS 100% 4.950 3.465 N APOBEC3H n/a
5 TRCN0000437034 ACGAAACGCAGTGCTACCAAG pLKO_005 333 CDS 100% 4.050 2.835 N APOBEC3H n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166004.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09758 pDONR223 100% 77.5% 75.2% None (many diffs) n/a
2 ccsbBroad304_09758 pLX_304 0% 77.5% 75.2% V5 (many diffs) n/a
Download CSV