Transcript: Mouse NM_001166009.1

Mus musculus transmembrane protein 215 (Tmem215), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Tmem215 (320500)
Length:
2276
CDS:
548..1255

Additional Resources:

NCBI RefSeq record:
NM_001166009.1
NBCI Gene record:
Tmem215 (320500)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001166009.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178972 CGACAAGATCATGGTTTCAAA pLKO.1 1836 3UTR 100% 5.625 4.500 N Tmem215 n/a
2 TRCN0000215731 CAATAGTCTGACCTGTTCATA pLKO.1 1245 CDS 100% 5.625 3.938 N Tmem215 n/a
3 TRCN0000173031 CCCAGGACAGTATCATCGTTT pLKO.1 1146 CDS 100% 4.950 3.465 N TMEM215 n/a
4 TRCN0000181110 CCTGGTCTTTGGTTTCATGTT pLKO.1 607 CDS 100% 4.950 3.465 N Tmem215 n/a
5 TRCN0000196208 GCAGGAAGAGACATCCAGATA pLKO.1 1009 CDS 100% 4.950 3.465 N Tmem215 n/a
6 TRCN0000184051 CATCGTTTGCTCCTACAAGCA pLKO.1 1159 CDS 100% 2.640 1.848 N Tmem215 n/a
7 TRCN0000178971 CTTTGGTTTCATGTTCACTGT pLKO.1 613 CDS 100% 2.640 1.848 N Tmem215 n/a
8 TRCN0000180771 GCTGGGACTTTATCTGAAGTT pLKO.1 1938 3UTR 100% 4.950 2.970 N Tmem215 n/a
9 TRCN0000428208 AGCCTTCACACTGTTAGAAAT pLKO_005 1334 3UTR 100% 13.200 9.240 N TMEM215 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166009.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.