Transcript: Human NM_001166060.1

Homo sapiens glycine receptor beta (GLRB), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
GLRB (2743)
Length:
3059
CDS:
186..1679

Additional Resources:

NCBI RefSeq record:
NM_001166060.1
NBCI Gene record:
GLRB (2743)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001166060.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412420 GTGCTCTAATAACGATGTATA pLKO_005 1858 3UTR 100% 13.200 18.480 N GLRB n/a
2 TRCN0000431492 TGCCAACTCCACTAGCAATAT pLKO_005 341 CDS 100% 13.200 18.480 N GLRB n/a
3 TRCN0000061710 GAACAGGTTATTGGTCAGTTA pLKO.1 365 CDS 100% 4.950 6.930 N GLRB n/a
4 TRCN0000432985 ACTGATGATTTACGATTTATC pLKO_005 807 CDS 100% 13.200 9.240 N GLRB n/a
5 TRCN0000061708 GCAAAGCGAATTGATCTTTAT pLKO.1 1593 CDS 100% 13.200 9.240 N GLRB n/a
6 TRCN0000419237 GTCAGCATGAGGTTATCTATT pLKO_005 702 CDS 100% 13.200 9.240 N GLRB n/a
7 TRCN0000426729 AGTCTGATCTGAGATCTAATG pLKO_005 1420 CDS 100% 10.800 7.560 N GLRB n/a
8 TRCN0000061711 CCTTTGGACTTGACATTGTTT pLKO.1 735 CDS 100% 5.625 3.938 N GLRB n/a
9 TRCN0000061709 GCTTATTGCTTGCCTTCTCTT pLKO.1 1181 CDS 100% 4.950 3.465 N GLRB n/a
10 TRCN0000061712 CCAACAATGTACAAGTGTTTA pLKO.1 579 CDS 100% 13.200 7.920 N GLRB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166060.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.