Transcript: Human NM_001166226.1

Homo sapiens centrosomal protein 120 (CEP120), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
CEP120 (153241)
Length:
4647
CDS:
114..2996

Additional Resources:

NCBI RefSeq record:
NM_001166226.1
NBCI Gene record:
CEP120 (153241)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001166226.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129963 GCGACAAGAATTGTTGGATAT pLKO.1 2723 CDS 100% 10.800 15.120 N CEP120 n/a
2 TRCN0000319250 GCGACAAGAATTGTTGGATAT pLKO_005 2723 CDS 100% 10.800 15.120 N CEP120 n/a
3 TRCN0000128581 GAGACCAATTGTAACCAGTTT pLKO.1 3415 3UTR 100% 4.950 6.930 N CEP120 n/a
4 TRCN0000127704 GAAAGTCAAATGGCTCGTCTT pLKO.1 2625 CDS 100% 4.050 3.240 N CEP120 n/a
5 TRCN0000129872 GCGGTAATTTCCAGTTCTATA pLKO.1 3309 3UTR 100% 13.200 9.240 N CEP120 n/a
6 TRCN0000349605 GCGGTAATTTCCAGTTCTATA pLKO_005 3309 3UTR 100% 13.200 9.240 N CEP120 n/a
7 TRCN0000129826 CAAGACACCTTCTTAAGGATT pLKO.1 1599 CDS 100% 4.950 3.465 N CEP120 n/a
8 TRCN0000319177 CAAGACACCTTCTTAAGGATT pLKO_005 1599 CDS 100% 4.950 3.465 N CEP120 n/a
9 TRCN0000128398 GATTATTTGACTCGCCTGATA pLKO.1 2862 CDS 100% 4.950 3.465 N CEP120 n/a
10 TRCN0000319178 GATTATTTGACTCGCCTGATA pLKO_005 2862 CDS 100% 4.950 3.465 N CEP120 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166226.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14406 pDONR223 100% 34.7% 32.1% None (many diffs) n/a
2 ccsbBroad304_14406 pLX_304 0% 34.7% 32.1% V5 (many diffs) n/a
Download CSV