Transcript: Mouse NM_001166382.1

Mus musculus RAD52 homolog, DNA repair protein (Rad52), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rad52 (19365)
Length:
1695
CDS:
146..1405

Additional Resources:

NCBI RefSeq record:
NM_001166382.1
NBCI Gene record:
Rad52 (19365)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001166382.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375250 TACGTGGGAGTCTGTGCATTT pLKO_005 458 CDS 100% 10.800 15.120 N Rad52 n/a
2 TRCN0000124108 GCCAGTATACAGCGGATGAAT pLKO.1 234 CDS 100% 5.625 7.875 N Rad52 n/a
3 TRCN0000124105 GCATTTGTAAAGGTGCAGTTA pLKO.1 473 CDS 100% 4.950 6.930 N Rad52 n/a
4 TRCN0000018870 CGGGTAATTAATCTGGCCAAT pLKO.1 356 CDS 100% 4.050 5.670 N RAD52 n/a
5 TRCN0000277235 CAGACTTAGAGGACATCATTA pLKO_005 1161 CDS 100% 13.200 10.560 N Rad52 n/a
6 TRCN0000375252 GACTGGGTCCAGAGTACATTA pLKO_005 285 CDS 100% 13.200 10.560 N Rad52 n/a
7 TRCN0000233365 TAGAGGAAGCTAACTACTTAA pLKO_005 1508 3UTR 100% 13.200 10.560 N Rad52 n/a
8 TRCN0000233363 ACTATCTGAGGTCACTAAATA pLKO_005 657 CDS 100% 15.000 10.500 N Rad52 n/a
9 TRCN0000375186 TCCCTCTTGATGTGGATTTAA pLKO_005 693 CDS 100% 15.000 10.500 N Rad52 n/a
10 TRCN0000233362 TTGAAGGTCATCGGGTAATTA pLKO_005 345 CDS 100% 15.000 10.500 N Rad52 n/a
11 TRCN0000124107 CATTTGTAAAGGTGCAGTTAA pLKO.1 474 CDS 100% 13.200 9.240 N Rad52 n/a
12 TRCN0000233361 CCAGTATACAGCGGATGAATA pLKO_005 235 CDS 100% 13.200 9.240 N Rad52 n/a
13 TRCN0000375184 CCCACATGACTCGAACATTAA pLKO_005 838 CDS 100% 13.200 9.240 N Rad52 n/a
14 TRCN0000375183 GATGTCACTAGACCGTCACAA pLKO_005 1413 3UTR 100% 4.950 3.465 N Rad52 n/a
15 TRCN0000375253 ATTGTTCCACCTTGGCTCATG pLKO_005 1467 3UTR 100% 4.050 2.835 N Rad52 n/a
16 TRCN0000124104 GCTGAACTCTTTAGAGGACTA pLKO.1 1487 3UTR 100% 4.050 2.835 N Rad52 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166382.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.