Transcript: Mouse NM_001166553.1

Mus musculus ring finger protein 145 (Rnf145), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rnf145 (74315)
Length:
4279
CDS:
325..1125

Additional Resources:

NCBI RefSeq record:
NM_001166553.1
NBCI Gene record:
Rnf145 (74315)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001166553.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226314 TATGCATTACGTAGGTTATAT pLKO_005 495 CDS 100% 15.000 21.000 N Rnf145 n/a
2 TRCN0000193419 CCTATGAAGGACCAATGTATT pLKO.1 647 CDS 100% 13.200 18.480 N Rnf145 n/a
3 TRCN0000176298 CTAATCTCCTAGTACCGTATA pLKO.1 890 CDS 100% 10.800 15.120 N Rnf145 n/a
4 TRCN0000226315 TAATCTCCTAGTACCGTATAA pLKO_005 891 CDS 100% 13.200 10.560 N Rnf145 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001166553.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09703 pDONR223 100% 34.9% 39.3% None (many diffs) n/a
2 ccsbBroad304_09703 pLX_304 0% 34.9% 39.3% V5 (many diffs) n/a
Download CSV