Transcript: Human NM_001167574.2

Homo sapiens uroplakin 3A (UPK3A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
UPK3A (7380)
Length:
721
CDS:
66..566

Additional Resources:

NCBI RefSeq record:
NM_001167574.2
NBCI Gene record:
UPK3A (7380)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001167574.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438889 ACGACTCACGACTCCCAAATC pLKO_005 432 CDS 100% 10.800 15.120 N UPK3A n/a
2 TRCN0000184537 GAGGCATGATCGTCATCACTT pLKO.1 319 CDS 100% 4.950 6.930 N UPK3A n/a
3 TRCN0000437952 TGGACAGGGCTGAGGTGTATT pLKO_005 526 CDS 100% 13.200 9.240 N UPK3A n/a
4 TRCN0000447020 CCAACTGGCCAGTGTGACTTT pLKO_005 134 CDS 100% 4.950 3.465 N UPK3A n/a
5 TRCN0000130697 CATGATCGTCATCACTTCCAT pLKO.1 323 CDS 100% 3.000 2.100 N UPK3A n/a
6 TRCN0000146504 CCTTCTTTCTACTTGTGGGTT pLKO.1 358 CDS 100% 2.640 1.848 N UPK3A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001167574.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.