Transcript: Human NM_001167621.1

Homo sapiens ataxin 10 (ATXN10), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
ATXN10 (25814)
Length:
3148
CDS:
267..1502

Additional Resources:

NCBI RefSeq record:
NM_001167621.1
NBCI Gene record:
ATXN10 (25814)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001167621.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294371 TGACCCAGTGGGTGATATATG pLKO_005 1315 CDS 100% 13.200 18.480 N ATXN10 n/a
2 TRCN0000307307 TAGTAGAGTTTAACGTGTATA pLKO_005 1631 3UTR 100% 13.200 10.560 N ATXN10 n/a
3 TRCN0000084097 GCAGATGCATCCCTACTTAAA pLKO.1 1407 CDS 100% 13.200 9.240 N ATXN10 n/a
4 TRCN0000286966 GCAGATGCATCCCTACTTAAA pLKO_005 1407 CDS 100% 13.200 9.240 N ATXN10 n/a
5 TRCN0000084095 CCCAAACTGAACAATCAAGAA pLKO.1 780 CDS 100% 4.950 3.465 N ATXN10 n/a
6 TRCN0000287029 CCCAAACTGAACAATCAAGAA pLKO_005 780 CDS 100% 4.950 3.465 N ATXN10 n/a
7 TRCN0000084093 CCTGTGCGAAATGACTGTGAA pLKO.1 1001 CDS 100% 4.950 3.465 N ATXN10 n/a
8 TRCN0000286965 CCTGTGCGAAATGACTGTGAA pLKO_005 1001 CDS 100% 4.950 3.465 N ATXN10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001167621.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.