Transcript: Mouse NM_001167784.1

Mus musculus T cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3 (Tcirg1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-11
Taxon:
Mus musculus (mouse)
Gene:
Tcirg1 (27060)
Length:
3045
CDS:
465..2969

Additional Resources:

NCBI RefSeq record:
NM_001167784.1
NBCI Gene record:
Tcirg1 (27060)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001167784.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348317 CCTCATTCACTTCATCAATAT pLKO_005 2285 CDS 100% 13.200 18.480 N Tcirg1 n/a
2 TRCN0000101696 CCTGCAACTTGGATGACCTTT pLKO.1 1104 CDS 100% 4.950 3.960 N Tcirg1 n/a
3 TRCN0000101697 CGGACTGCTCATGTTTCTCTT pLKO.1 1694 CDS 100% 4.950 3.960 N Tcirg1 n/a
4 TRCN0000363823 CGGACTGCTCATGTTTCTCTT pLKO_005 1694 CDS 100% 4.950 3.960 N Tcirg1 n/a
5 TRCN0000101699 GAGTTCAGAGACCTCAACGAA pLKO.1 570 CDS 100% 3.000 2.400 N Tcirg1 n/a
6 TRCN0000348246 ATTCAGACCTGAAGGTCAATT pLKO_005 952 CDS 100% 13.200 9.240 N Tcirg1 n/a
7 TRCN0000348316 TCAGCCGAGCCACCACTATTT pLKO_005 1861 CDS 100% 13.200 9.240 N Tcirg1 n/a
8 TRCN0000374809 ACACTGGCTTCATCTACAATG pLKO_005 1834 CDS 100% 10.800 7.560 N Tcirg1 n/a
9 TRCN0000348315 AGGAACTGGAGAAGACGTTTA pLKO_005 640 CDS 100% 10.800 7.560 N Tcirg1 n/a
10 TRCN0000374875 GCTACCTTGTGTTCCTCATTG pLKO_005 2212 CDS 100% 10.800 7.560 N Tcirg1 n/a
11 TRCN0000101695 CCCTAACATCACTGGTGTCTT pLKO.1 1970 CDS 100% 4.950 3.465 N Tcirg1 n/a
12 TRCN0000101698 CCTCAACCAGTGCAGTGTGAA pLKO.1 1382 CDS 100% 4.950 3.465 N Tcirg1 n/a
13 TRCN0000038638 CAACTCCTTCAAGATGAAGAT pLKO.1 2057 CDS 100% 4.950 2.475 Y TCIRG1 n/a
14 TRCN0000289223 CAACTCCTTCAAGATGAAGAT pLKO_005 2057 CDS 100% 4.950 2.475 Y TCIRG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001167784.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.