Transcript: Mouse NM_001167792.1

Mus musculus predicted gene 3286 (Gm3286), transcript variant 3, mRNA.

Source:
NCBI, updated 2013-04-18
Taxon:
Mus musculus (mouse)
Gene:
Gm3286 (100041354)
Length:
1410
CDS:
122..976

Additional Resources:

NCBI RefSeq record:
NM_001167792.1
NBCI Gene record:
Gm3286 (100041354)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001167792.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255001 CCATCACTCACTGCCTAATTT pLKO_005 438 CDS 100% 15.000 7.500 Y Gm16367 n/a
2 TRCN0000255000 ATTATTTGCTCTCGATCTTAT pLKO_005 535 CDS 100% 13.200 6.600 Y Gm16367 n/a
3 TRCN0000269611 CAAGATGAATGTGGAACAATA pLKO_005 757 CDS 100% 13.200 6.600 Y E330014E10Rik n/a
4 TRCN0000269612 CAGACTCAACAAGCTCATAAA pLKO_005 259 CDS 100% 13.200 6.600 Y E330014E10Rik n/a
5 TRCN0000262970 CATCACTCACTGCCTAATTTC pLKO_005 439 CDS 100% 13.200 6.600 Y Gm3286 n/a
6 TRCN0000262966 GCAGACTCAACAAGCTCATAA pLKO_005 258 CDS 100% 13.200 6.600 Y Gm3286 n/a
7 TRCN0000269549 TCCATCACTCACTGCCTAATT pLKO_005 437 CDS 100% 13.200 6.600 Y E330014E10Rik n/a
8 TRCN0000262967 AGATAGAAATGTGGACTATTC pLKO_005 1121 3UTR 100% 10.800 5.400 Y Gm3286 n/a
9 TRCN0000193744 CCAGGTGAATATGGCATGTAT pLKO.1 1365 3UTR 100% 5.625 2.813 Y D5Ertd577e n/a
10 TRCN0000175000 GAGAAAGATTTGTGGAACTTT pLKO.1 822 CDS 100% 5.625 2.813 Y D5Ertd577e n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001167792.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.