Transcript: Mouse NM_001167875.1

Mus musculus cytochrome P450, family 2, subfamily c, polypeptide 50 (Cyp2c50), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Cyp2c50 (107141)
Length:
1657
CDS:
22..1317

Additional Resources:

NCBI RefSeq record:
NM_001167875.1
NBCI Gene record:
Cyp2c50 (107141)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001167875.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126971 CTAATGGAATGGGCATTATAT pLKO.1 341 CDS 100% 1.500 1.050 N Cyp2c50 n/a
2 TRCN0000126972 GCTGCGTGATAGCAAAGAGTT pLKO.1 1026 CDS 100% 4.950 2.970 N Cyp2c50 n/a
3 TRCN0000250523 ATGTCATCTGCTCAATTATTT pLKO_005 548 CDS 100% 15.000 7.500 Y Cyp2c54 n/a
4 TRCN0000250522 GCCAATCCTTCACCAATTTAT pLKO_005 173 CDS 100% 15.000 7.500 Y Cyp2c54 n/a
5 TRCN0000126973 GCCCTATACTGATGCCATGAT pLKO.1 879 CDS 100% 4.950 2.475 Y Cyp2c50 n/a
6 TRCN0000201672 GCGGAATTTAGGCATGGGAAA pLKO.1 414 CDS 100% 4.050 2.025 Y Cyp2c54 n/a
7 TRCN0000064107 CCTGTGACATTAAATTCAGAA pLKO.1 956 CDS 100% 4.950 2.475 Y CYP2C9 n/a
8 TRCN0000193255 CCTGTGACATTAAATTCAGAA pLKO.1 956 CDS 100% 4.950 2.475 Y Cyp2c38 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001167875.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.