Transcript: Mouse NM_001167907.1

Mus musculus predicted gene 4952 (Gm4952), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-02-22
Taxon:
Mus musculus (mouse)
Gene:
Gm4952 (240549)
Length:
1515
CDS:
125..1015

Additional Resources:

NCBI RefSeq record:
NM_001167907.1
NBCI Gene record:
Gm4952 (240549)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001167907.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103406 CCTGTGTATAATCATACAGAA pLKO.1 902 CDS 100% 0.495 0.693 N Gm4952 n/a
2 TRCN0000103408 CCAACCTAAATGAAGCAATAA pLKO.1 447 CDS 100% 13.200 9.240 N Gm4952 n/a
3 TRCN0000103407 CCGGGCTATTGACCAAGAAAT pLKO.1 604 CDS 100% 13.200 9.240 N Gm4952 n/a
4 TRCN0000103405 GCCATCATCTTTGTTTAGTTT pLKO.1 1229 3UTR 100% 5.625 3.938 N Gm4952 n/a
5 TRCN0000103409 AGGCCTTATCTCCCACATCAT pLKO.1 844 CDS 100% 4.950 3.465 N Gm4952 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001167907.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.