Transcript: Human NM_001168319.2

Homo sapiens endothelin 1 (EDN1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
EDN1 (1906)
Length:
2032
CDS:
270..905

Additional Resources:

NCBI RefSeq record:
NM_001168319.2
NBCI Gene record:
EDN1 (1906)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001168319.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272481 CCATGAGAAACAGCGTCAAAT pLKO_005 808 CDS 100% 13.200 18.480 N EDN1 n/a
2 TRCN0000272483 GCTCGTCCCTGATGGATAAAG pLKO_005 430 CDS 100% 13.200 18.480 N EDN1 n/a
3 TRCN0000003848 AGACAAGAAGTGCTGGAATTT pLKO.1 611 CDS 100% 13.200 9.240 N EDN1 n/a
4 TRCN0000413783 AGACAAGAAGTGCTGGAATTT pLKO_005 611 CDS 100% 13.200 9.240 N Edn1 n/a
5 TRCN0000272482 CAAGAGAGCCTTGGAGAATTT pLKO_005 536 CDS 100% 13.200 9.240 N EDN1 n/a
6 TRCN0000003851 AGACAAACATGCAAGTAAAGA pLKO.1 1361 3UTR 100% 5.625 3.938 N EDN1 n/a
7 TRCN0000284761 AGACAAACATGCAAGTAAAGA pLKO_005 1361 3UTR 100% 5.625 3.938 N EDN1 n/a
8 TRCN0000003849 GAGAAAGACTGGAATAATCAT pLKO.1 672 CDS 100% 5.625 3.938 N EDN1 n/a
9 TRCN0000003847 GCAGTTAGTGAGAGGAAGAAA pLKO.1 740 CDS 100% 5.625 3.938 N EDN1 n/a
10 TRCN0000284762 GCAGTTAGTGAGAGGAAGAAA pLKO_005 740 CDS 100% 5.625 3.938 N EDN1 n/a
11 TRCN0000003850 AGATGCCAATGTGCTAGCCAA pLKO.1 588 CDS 100% 2.640 1.848 N EDN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001168319.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.