Transcript: Mouse NM_001168476.1

Mus musculus tetratricopeptide repeat domain 23 (Ttc23), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ttc23 (67009)
Length:
2031
CDS:
764..1597

Additional Resources:

NCBI RefSeq record:
NM_001168476.1
NBCI Gene record:
Ttc23 (67009)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001168476.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247063 CTAGCGGAGGCGTATGTTAAT pLKO_005 512 5UTR 100% 13.200 18.480 N Ttc23 n/a
2 TRCN0000257628 TGGAGCGTACGCGAAGCTAAA pLKO_005 1375 CDS 100% 10.800 15.120 N Ttc23 n/a
3 TRCN0000200799 GCACTAACAAGAATTTGCTAT pLKO.1 473 5UTR 100% 4.950 3.960 N Ttc23 n/a
4 TRCN0000257751 ACGCCTCAGAGAACTTGATAA pLKO_005 720 5UTR 100% 13.200 9.240 N Ttc23 n/a
5 TRCN0000257634 AGTCAAGGCAATCGGTGAAAG pLKO_005 1503 CDS 100% 10.800 7.560 N Ttc23 n/a
6 TRCN0000257618 TGATATGGTGCTCTTGGTTAT pLKO_005 1787 3UTR 100% 10.800 7.560 N Ttc23 n/a
7 TRCN0000189974 GCTGTCGTTTGCACAGTTGTA pLKO.1 823 CDS 100% 4.950 3.465 N Ttc23 n/a
8 TRCN0000191618 GCTGTTTACTTCAGAATGCAA pLKO.1 1717 3UTR 100% 3.000 2.100 N Ttc23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001168476.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.