Transcript: Mouse NM_001170746.1

Mus musculus membrane associated guanylate kinase, WW and PDZ domain containing 2 (Magi2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Magi2 (50791)
Length:
6736
CDS:
244..4071

Additional Resources:

NCBI RefSeq record:
NM_001170746.1
NBCI Gene record:
Magi2 (50791)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001170746.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240803 ATATGAGCTCTACGAGAAATC pLKO_005 2466 CDS 100% 10.800 15.120 N Magi2 n/a
2 TRCN0000240805 AGCTGAACCAGCACCATTATT pLKO_005 810 CDS 100% 15.000 12.000 N Magi2 n/a
3 TRCN0000240804 CACAGTCGGTCCCAGATATTA pLKO_005 1904 CDS 100% 15.000 10.500 N Magi2 n/a
4 TRCN0000240801 TGTCACACGCATAGATCTATA pLKO_005 4662 3UTR 100% 13.200 9.240 N Magi2 n/a
5 TRCN0000240802 TCAATGGAAGACATAACTATG pLKO_005 1853 CDS 100% 10.800 7.560 N Magi2 n/a
6 TRCN0000148546 CAAGCTGAACTTATGACCTTA pLKO.1 2038 CDS 100% 4.950 3.465 N MAGI2 n/a
7 TRCN0000148688 CAAAGGATTTGGATTCAGCAT pLKO.1 3681 CDS 100% 2.640 1.848 N MAGI2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001170746.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.