Transcript: Mouse NM_001170855.1

Mus musculus tripartite motif-containing 36 (Trim36), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-04-22
Taxon:
Mus musculus (mouse)
Gene:
Trim36 (28105)
Length:
4555
CDS:
279..2432

Additional Resources:

NCBI RefSeq record:
NM_001170855.1
NBCI Gene record:
Trim36 (28105)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001170855.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173151 CCTTGTCTCTTCCACGTCATT pLKO.1 2713 3UTR 100% 4.950 3.960 N Trim36 n/a
2 TRCN0000193594 GCCTCTAAGAAACTAAGACTA pLKO.1 1209 CDS 100% 4.950 3.465 N Trim36 n/a
3 TRCN0000174856 GTCTGTCATAAGTGTGTGAAA pLKO.1 396 CDS 100% 4.950 3.465 N Trim36 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001170855.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08541 pDONR223 100% 85.1% 90.2% None (many diffs) n/a
2 ccsbBroad304_08541 pLX_304 0% 85.1% 90.2% V5 (many diffs) n/a
3 ccsbBroadEn_15900 pDONR223 0% 85.1% 90.1% None (many diffs) n/a
4 ccsbBroad304_15900 pLX_304 0% 85.1% 90.1% V5 (many diffs) n/a
Download CSV