Transcript: Mouse NM_001170912.1

Mus musculus tripartite motif-containing 66 (Trim66), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Trim66 (330627)
Length:
9192
CDS:
184..4218

Additional Resources:

NCBI RefSeq record:
NM_001170912.1
NBCI Gene record:
Trim66 (330627)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001170912.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126820 CCAGGCATTATTACCAGATTA pLKO.1 3788 CDS 100% 13.200 9.240 N Trim66 n/a
2 TRCN0000126821 GCTGCCTCTTATGGGAGTTTA pLKO.1 1324 CDS 100% 13.200 9.240 N Trim66 n/a
3 TRCN0000126819 CGCTGCTTCATTGAGCCATAT pLKO.1 8996 3UTR 100% 10.800 7.560 N Trim66 n/a
4 TRCN0000126823 CCAGCCTGATGAGTGTTTCAA pLKO.1 2516 CDS 100% 5.625 3.938 N Trim66 n/a
5 TRCN0000126822 GCACATAAGAAATCCAGCCTA pLKO.1 847 CDS 100% 2.640 1.848 N Trim66 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001170912.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.