Transcript: Human NM_001171184.1

Homo sapiens dystrophin related protein 2 (DRP2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Homo sapiens (human)
Gene:
DRP2 (1821)
Length:
6835
CDS:
321..2960

Additional Resources:

NCBI RefSeq record:
NM_001171184.1
NBCI Gene record:
DRP2 (1821)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001171184.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053580 CGCTTGGACCTGGTAACTTTA pLKO.1 1335 CDS 100% 13.200 18.480 N DRP2 n/a
2 TRCN0000420653 GAGCACATCCAGGCTATTAAG pLKO_005 894 CDS 100% 13.200 18.480 N DRP2 n/a
3 TRCN0000418372 GTTCGAGATCAGCCCTTTAAG pLKO_005 3195 3UTR 100% 13.200 18.480 N DRP2 n/a
4 TRCN0000053581 CCCGTATCCTTCGGCAACATA pLKO.1 2602 CDS 100% 5.625 7.875 N DRP2 n/a
5 TRCN0000108701 GCCATGAATCTGTGTTGGAAT pLKO.1 318 5UTR 100% 4.950 6.930 N Drp2 n/a
6 TRCN0000429460 GGACTTTGCCACAACCTTAAA pLKO_005 2087 CDS 100% 13.200 10.560 N DRP2 n/a
7 TRCN0000419350 GAAAGAGAGAAGCCTAATTAC pLKO_005 3334 3UTR 100% 13.200 9.240 N DRP2 n/a
8 TRCN0000053582 CCTCATTCTGAGAGCAAAGAT pLKO.1 627 CDS 100% 5.625 3.938 N DRP2 n/a
9 TRCN0000053579 CCTAAGCCTAAAGCTGTTGAA pLKO.1 260 5UTR 100% 4.950 3.465 N DRP2 n/a
10 TRCN0000053578 GCATCAGACCAAGTGCTCTAT pLKO.1 1901 CDS 100% 4.950 2.970 N DRP2 n/a
11 TRCN0000108704 GCTGAGCAAGTGAAGCATCAA pLKO.1 1887 CDS 100% 4.950 3.465 N Drp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001171184.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.