Transcript: Mouse NM_001171801.1

Mus musculus triple QxxK/R motif containing (Triqk), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Triqk (208820)
Length:
1501
CDS:
274..534

Additional Resources:

NCBI RefSeq record:
NM_001171801.1
NBCI Gene record:
Triqk (208820)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001171801.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426835 ACTTCCTGTTGATCAGTACAG pLKO_005 303 CDS 100% 4.050 2.835 N TRIQK n/a
2 TRCN0000179477 GCAGTGTAACAATCTGCCATT pLKO.1 1310 3UTR 100% 4.050 2.835 N Triqk n/a
3 TRCN0000183387 GAAAGCCATAGGAAATTGCTA pLKO.1 956 3UTR 100% 3.000 2.100 N Triqk n/a
4 TRCN0000179509 GCCATTTAATTGTGCAGGGTT pLKO.1 1325 3UTR 100% 2.640 1.848 N Triqk n/a
5 TRCN0000184342 GACTATCTGCACATACAGGCA pLKO.1 1027 3UTR 100% 0.660 0.396 N Triqk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001171801.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.