Transcript: Human NM_001172223.3

Homo sapiens MOB kinase activator 2 (MOB2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
MOB2 (81532)
Length:
1745
CDS:
224..1030

Additional Resources:

NCBI RefSeq record:
NM_001172223.3
NBCI Gene record:
MOB2 (81532)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001172223.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166012 GCGAGATTGACCTTAACGAGT pLKO.1 459 CDS 100% 2.640 3.696 N MOB2 n/a
2 TRCN0000164939 GATTGACCTTAACGAGTGGCT pLKO.1 463 CDS 100% 0.660 0.924 N MOB2 n/a
3 TRCN0000165158 GATCACCGACTTCCAGTTCAA pLKO.1 418 CDS 100% 4.950 3.960 N MOB2 n/a
4 TRCN0000166317 CGTGTGCAACACACAGTACTA pLKO.1 577 CDS 100% 4.950 3.465 N MOB2 n/a
5 TRCN0000166788 CAGTACGTTGACTTCGTCATG pLKO.1 641 CDS 100% 4.050 2.835 N MOB2 n/a
6 TRCN0000162484 CGTTTGTAGAGAAGAGCCTTT pLKO.1 1233 3UTR 100% 4.050 2.835 N MOB2 n/a
7 TRCN0000165481 GAAGATCTGCAGACACCTGTT pLKO.1 751 CDS 100% 4.050 2.430 N MOB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001172223.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09065 pDONR223 100% 87.2% 86.1% None (many diffs) n/a
Download CSV