Transcript: Human NM_001174127.1

Homo sapiens solute carrier family 11 member 2 (SLC11A2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
SLC11A2 (4891)
Length:
3790
CDS:
141..1847

Additional Resources:

NCBI RefSeq record:
NM_001174127.1
NBCI Gene record:
SLC11A2 (4891)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001174127.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079535 GCCTGAACTCTATCTTCTGAA pLKO.1 1793 CDS 100% 4.950 3.960 N Slc11a2 n/a
2 TRCN0000043250 CCACCATGACAGGAACCTATT pLKO.1 1297 CDS 100% 10.800 7.560 N SLC11A2 n/a
3 TRCN0000043252 CGGCCAGTAATGAGTGACTTT pLKO.1 1530 CDS 100% 4.950 3.465 N SLC11A2 n/a
4 TRCN0000043248 GCTATCAATCTTCTGTCTGTA pLKO.1 651 CDS 100% 4.950 3.465 N SLC11A2 n/a
5 TRCN0000043251 GCTTTCGTAAACTCTGGGCTT pLKO.1 337 CDS 100% 2.160 1.512 N SLC11A2 n/a
6 TRCN0000139826 CCTCCTGAATAGCTGGGATTA pLKO.1 3179 3UTR 100% 10.800 5.400 Y SYNPO2 n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3293 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3293 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001174127.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.