Transcript: Mouse NM_001174169.2

Mus musculus transmembrane and immunoglobulin domain containing 3 (Tmigd3), transcript variant 3, mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Tmigd3 (69296)
Length:
1794
CDS:
240..761

Additional Resources:

NCBI RefSeq record:
NM_001174169.2
NBCI Gene record:
Tmigd3 (69296)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001174169.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432472 TTCGCATGTGGTATCAGTAAA pLKO_005 796 3UTR 100% 13.200 6.600 Y Adora3 n/a
2 TRCN0000435573 TTGAGCTTCTCTAATTCAATT pLKO_005 949 3UTR 100% 13.200 6.600 Y Adora3 n/a
3 TRCN0000026272 CGTGGTCAGTTTGGATTACAT pLKO.1 314 CDS 100% 5.625 2.813 Y Adora3 n/a
4 TRCN0000026301 CCTATTGTCTACGCCTGCAAA pLKO.1 639 CDS 100% 4.950 2.475 Y Adora3 n/a
5 TRCN0000026240 CCTCAGATTCTTTGGACTCAA pLKO.1 718 CDS 100% 4.950 2.475 Y Adora3 n/a
6 TRCN0000026307 CCAGACAAAGAAGTAATGGAA pLKO.1 1031 3UTR 100% 3.000 1.500 Y Adora3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001174169.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.