Transcript: Mouse NM_001177399.1

Mus musculus zinc finger protein 971 (Zfp971), transcript variant 1, mRNA.

Source:
NCBI, updated 2016-06-08
Taxon:
Mus musculus (mouse)
Gene:
Zfp971 (626848)
Length:
3345
CDS:
96..1508

Additional Resources:

NCBI RefSeq record:
NM_001177399.1
NBCI Gene record:
Zfp971 (626848)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001177399.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235198 GAGCAACACTCTGAGTTTATT pLKO_005 309 CDS 100% 15.000 7.500 Y n/a
2 TRCN0000240262 AGCAACACTCTGAGTTTATTC pLKO_005 310 CDS 100% 13.200 6.600 Y Zfp966 n/a
3 TRCN0000226094 AGTGGTCTCCAATGCCATAAA pLKO_005 1533 3UTR 100% 13.200 6.600 Y Gm2004 n/a
4 TRCN0000234204 AGTGGTCTCCAATGCCATAAA pLKO_005 1533 3UTR 100% 13.200 6.600 Y Gm14403 n/a
5 TRCN0000242399 CAGTCATCTCCGAATACATAA pLKO_005 1448 CDS 100% 13.200 6.600 Y Gm14432 n/a
6 TRCN0000242355 CTGTCATCTCCAAATACATAA pLKO_005 1364 CDS 100% 13.200 6.600 Y Gm14391 n/a
7 TRCN0000242348 ACATACAATTGAAGACCATTT pLKO_005 242 CDS 100% 10.800 5.400 Y Gm14393 n/a
8 TRCN0000347519 AGAAGCAGTCATCTCCGAATA pLKO_005 1443 CDS 100% 10.800 5.400 Y Zfp931 n/a
9 TRCN0000239829 AGGAGAGAAACCCTATGAATG pLKO_005 473 CDS 100% 10.800 5.400 Y Gm14393 n/a
10 TRCN0000235200 AGTCATCTCGGAATCCATAAG pLKO_005 693 CDS 100% 10.800 5.400 Y n/a
11 TRCN0000243733 ATAGGAATCTCACAGCTATAG pLKO_005 205 CDS 100% 10.800 5.400 Y Gm14322 n/a
12 TRCN0000226045 CAGTCATCTCGGAATCCATAA pLKO_005 692 CDS 100% 10.800 5.400 Y Zfp970 n/a
13 TRCN0000239453 CATACAATTGAAGACCATTTC pLKO_005 243 CDS 100% 10.800 5.400 Y Gm14288 n/a
14 TRCN0000239455 CTCAGAAGAGTCTCTACAAAG pLKO_005 166 CDS 100% 10.800 5.400 Y Gm14288 n/a
15 TRCN0000243739 GAATGTAAACAATGTGGTAAA pLKO_005 657 CDS 100% 10.800 5.400 Y Gm14411 n/a
16 TRCN0000242409 GAATGTAACCAATGTGGTAAA pLKO_005 573 CDS 100% 10.800 5.400 Y Gm14418 n/a
17 TRCN0000242347 GAGTTTATTCAATGTGGTAAA pLKO_005 321 CDS 100% 10.800 5.400 Y Gm14393 n/a
18 TRCN0000239454 TGTGATGGTAGAGACCTATAG pLKO_005 188 CDS 100% 10.800 5.400 Y Gm14288 n/a
19 TRCN0000243741 ACTCAGGAAGAGTGGGCTTTG pLKO_005 135 CDS 100% 6.000 3.000 Y Gm14411 n/a
20 TRCN0000190377 CGAACACATACAGGAGAGAAA pLKO.1 462 CDS 100% 4.950 2.475 Y Gm14296 n/a
21 TRCN0000242406 GAGTCTCTACAAAGGTGTGAT pLKO_005 173 CDS 100% 4.950 2.475 Y Gm14418 n/a
22 TRCN0000202246 GCGAACACATACAGGAGAGAA pLKO.1 629 CDS 100% 4.950 2.475 Y Gm14296 n/a
23 TRCN0000095226 CATGTGAACTTCACTCAGGAA pLKO.1 123 CDS 100% 2.640 1.320 Y Zfp950 n/a
24 TRCN0000284687 TACAGGAGAGAAACCTTATAA pLKO_005 974 CDS 100% 15.000 7.500 Y Zfp984 n/a
25 TRCN0000281870 GTCATCTCCAAATACATAATC pLKO_005 1366 CDS 100% 13.200 6.600 Y Gm14308 n/a
26 TRCN0000262238 TACAGGAGAGAAACCCTATAA pLKO_005 470 CDS 100% 13.200 6.600 Y Gm14305 n/a
27 TRCN0000242397 TGGTAAAGCCTTTGCAGTAAT pLKO_005 671 CDS 100% 13.200 6.600 Y Gm14432 n/a
28 TRCN0000262235 TGTCATCTCCAAATACATAAT pLKO_005 1365 CDS 100% 13.200 6.600 Y Gm14305 n/a
29 TRCN0000284677 ACAATGTGGTAAAGCCTTTAC pLKO_005 665 CDS 100% 10.800 5.400 Y Gm14410 n/a
30 TRCN0000284648 ATACAGGAGAGAAACCCTATA pLKO_005 469 CDS 100% 10.800 5.400 Y Gm14308 n/a
31 TRCN0000281930 GGTAAAGCCTTTGCAGTAATC pLKO_005 672 CDS 100% 10.800 5.400 Y Gm14308 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001177399.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.