Transcript: Human NM_001177591.2

Homo sapiens protein phosphatase 2 regulatory subunit Balpha (PPP2R2A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
PPP2R2A (5520)
Length:
3672
CDS:
32..1405

Additional Resources:

NCBI RefSeq record:
NM_001177591.2
NBCI Gene record:
PPP2R2A (5520)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001177591.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002493 GCAAGTGGCAAGCGAAAGAAA pLKO.1 1256 CDS 100% 5.625 7.875 N PPP2R2A n/a
2 TRCN0000338192 GCAAGTGGCAAGCGAAAGAAA pLKO_005 1256 CDS 100% 5.625 7.875 N PPP2R2A n/a
3 TRCN0000002491 TCCTGCTTAGTTGAGATAGTT pLKO.1 1435 3UTR 100% 5.625 7.875 N PPP2R2A n/a
4 TRCN0000338193 TCCTGCTTAGTTGAGATAGTT pLKO_005 1435 3UTR 100% 5.625 7.875 N PPP2R2A n/a
5 TRCN0000002490 GATCCCAGTAACAGGTCATTT pLKO.1 881 CDS 100% 13.200 10.560 N PPP2R2A n/a
6 TRCN0000338248 GATCCCAGTAACAGGTCATTT pLKO_005 881 CDS 100% 13.200 10.560 N PPP2R2A n/a
7 TRCN0000380440 GCAGATGATTTGCGGATTAAT pLKO_005 644 CDS 100% 15.000 10.500 N PPP2R2A n/a
8 TRCN0000381241 CTTTAGGCCTATGGATCTAAT pLKO_005 529 CDS 100% 13.200 9.240 N PPP2R2A n/a
9 TRCN0000002489 AGAAACACAAAGCGAGACATA pLKO.1 1172 CDS 100% 4.950 3.465 N PPP2R2A n/a
10 TRCN0000002492 GTAGATGATGATGTAGCAGAA pLKO.1 122 CDS 100% 4.050 2.835 N PPP2R2A n/a
11 TRCN0000338191 GTAGATGATGATGTAGCAGAA pLKO_005 122 CDS 100% 4.050 2.835 N PPP2R2A n/a
12 TRCN0000425449 ATGCTCATACATATCACATAA pLKO_005 582 CDS 100% 13.200 9.240 N Ppp2r2d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001177591.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.