Transcript: Human NM_001177660.2

Homo sapiens hyaluronan binding protein 2 (HABP2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
HABP2 (3026)
Length:
2987
CDS:
141..1745

Additional Resources:

NCBI RefSeq record:
NM_001177660.2
NBCI Gene record:
HABP2 (3026)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001177660.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378671 ATTACAGCTACGAGGATTATA pLKO_005 190 CDS 100% 15.000 10.500 N HABP2 n/a
2 TRCN0000356286 TGCCCACTGCACCGACATAAA pLKO_005 1142 CDS 100% 13.200 9.240 N HABP2 n/a
3 TRCN0000356284 ACGGCACCTACTACGTCTATG pLKO_005 1615 CDS 100% 10.800 7.560 N HABP2 n/a
4 TRCN0000006831 CCGCTGCTGAAATCAAACATA pLKO.1 2453 3UTR 100% 5.625 3.938 N HABP2 n/a
5 TRCN0000006835 CCAACTCTATGACCACATGAT pLKO.1 1502 CDS 100% 4.950 3.465 N HABP2 n/a
6 TRCN0000006834 TCTGGGAATAAGTGTCAGAAA pLKO.1 372 CDS 100% 4.950 3.465 N HABP2 n/a
7 TRCN0000006832 CCAAGTTACCAAATTCCTGAA pLKO.1 1685 CDS 100% 4.050 2.835 N HABP2 n/a
8 TRCN0000006833 GACCTGAAGAAAGAAGAATTT pLKO.1 1197 CDS 100% 13.200 7.920 N HABP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001177660.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00721 pDONR223 100% 95.3% 95.3% None 0_1ins78 n/a
Download CSV