Transcript: Mouse NM_001177731.1

Mus musculus melanocortin 2 receptor accessory protein 2 (Mrap2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Mrap2 (244958)
Length:
2093
CDS:
239..862

Additional Resources:

NCBI RefSeq record:
NM_001177731.1
NBCI Gene record:
Mrap2 (244958)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001177731.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251304 CCTGGGAATACGAGTACTATG pLKO_005 309 CDS 100% 10.800 15.120 N Mrap2 n/a
2 TRCN0000251306 GAAACAATTAGCCACATATAT pLKO_005 1165 3UTR 100% 15.000 10.500 N Mrap2 n/a
3 TRCN0000251305 GAAGGACTGAAGGCTCATAAA pLKO_005 350 CDS 100% 13.200 9.240 N Mrap2 n/a
4 TRCN0000251307 AGGTCTCTGTTCCACTGTTAC pLKO_005 581 CDS 100% 10.800 7.560 N Mrap2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001177731.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04629 pDONR223 100% 85.5% 86.9% None (many diffs) n/a
2 ccsbBroad304_04629 pLX_304 0% 85.5% 86.9% V5 (many diffs) n/a
3 TRCN0000468654 ACCCTGAACCAGGATCTACTAACG pLX_317 60.7% 85.5% 86.9% V5 (many diffs) n/a
Download CSV