Transcript: Mouse NM_001177853.1

Mus musculus aspartate-beta-hydroxylase (Asph), transcript variant 7, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Asph (65973)
Length:
2693
CDS:
168..953

Additional Resources:

NCBI RefSeq record:
NM_001177853.1
NBCI Gene record:
Asph (65973)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001177853.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263213 GGTTTGACTTGGTCGATTATG pLKO_005 301 CDS 100% 13.200 18.480 N Asph n/a
2 TRCN0000112743 GCATCGCAGAACCATCCAAAT pLKO.1 687 CDS 100% 10.800 8.640 N Asph n/a
3 TRCN0000263209 GACTATGATGAACCAGTATAT pLKO_005 810 CDS 100% 13.200 9.240 N Asph n/a
4 TRCN0000112742 CCGGGACAGTTCATGAAGAAA pLKO.1 637 CDS 100% 5.625 3.938 N Asph n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001177853.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.