Transcript: Mouse NM_001177871.1

Mus musculus filamin A interacting protein 1-like (Filip1l), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Filip1l (78749)
Length:
3253
CDS:
214..2895

Additional Resources:

NCBI RefSeq record:
NM_001177871.1
NBCI Gene record:
Filip1l (78749)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001177871.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136529 CCAATAAAGTCACCAGCAGTA pLKO.1 2804 CDS 100% 4.050 5.670 N FILIP1L n/a
2 TRCN0000136993 CCATTGAAAGTCGGCTAGAAA pLKO.1 914 CDS 100% 5.625 4.500 N FILIP1L n/a
3 TRCN0000346916 TGATAACTACTGAGGATAATA pLKO_005 2654 CDS 100% 15.000 10.500 N Filip1l n/a
4 TRCN0000346989 TGGCCACAGAGGACCTAATAT pLKO_005 1682 CDS 100% 15.000 10.500 N Filip1l n/a
5 TRCN0000346991 GCAGCACTCAGTCGGCAAATT pLKO_005 475 CDS 100% 13.200 9.240 N Filip1l n/a
6 TRCN0000346987 GAGTATCTGGAACTAACTATG pLKO_005 3028 3UTR 100% 10.800 7.560 N Filip1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001177871.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02661 pDONR223 100% 89.2% 90.9% None (many diffs) n/a
2 ccsbBroad304_02661 pLX_304 0% 89.2% 90.9% V5 (many diffs) n/a
Download CSV