Transcript: Mouse NM_001177953.1

Mus musculus retinitis pigmentosa GTPase regulator (Rpgr), transcript variant 5, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Rpgr (19893)
Length:
2711
CDS:
103..1776

Additional Resources:

NCBI RefSeq record:
NM_001177953.1
NBCI Gene record:
Rpgr (19893)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001177953.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314113 CCTAAATTTGAAGACGTATAT pLKO_005 1339 CDS 100% 13.200 10.560 N Rpgr n/a
2 TRCN0000110091 CGACATGGAAAGTTAGGACTT pLKO.1 1183 CDS 100% 4.050 3.240 N Rpgr n/a
3 TRCN0000314112 ACAGATACTGGTGGCGTATAT pLKO_005 523 CDS 100% 13.200 9.240 N Rpgr n/a
4 TRCN0000047477 CCTGGATCTCTTGTGGATATT pLKO.1 794 CDS 100% 13.200 9.240 N RPGR n/a
5 TRCN0000350048 TGGATCTCTTGTGGATATTAC pLKO_005 796 CDS 100% 13.200 9.240 N Rpgr n/a
6 TRCN0000067633 CCAAGGTCTATTCCCTTATTT pLKO.1 2083 3UTR 100% 15.000 7.500 Y Fcer2a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001177953.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.