Transcript: Mouse NM_001177978.1

Mus musculus acyl-CoA synthetase medium-chain family member 2 (Acsm2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-11
Taxon:
Mus musculus (mouse)
Gene:
Acsm2 (233799)
Length:
6542
CDS:
115..1857

Additional Resources:

NCBI RefSeq record:
NM_001177978.1
NBCI Gene record:
Acsm2 (233799)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001177978.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000441396 GGCGGTCAGACGATATCATTA pLKO_005 1496 CDS 100% 13.200 18.480 N Acsm2 n/a
2 TRCN0000422677 GTATTGGGAGCATGCATATTT pLKO_005 949 CDS 100% 15.000 12.000 N Acsm2 n/a
3 TRCN0000421083 TGAGTACTTCTGACATAATAT pLKO_005 869 CDS 100% 15.000 10.500 N Acsm2 n/a
4 TRCN0000414320 AGGACTGGAAATCCGAGAAAT pLKO_005 1176 CDS 100% 13.200 9.240 N Acsm2 n/a
5 TRCN0000112447 CCAGACAGAAACGGGACTTAT pLKO.1 1203 CDS 100% 13.200 9.240 N Acsm2 n/a
6 TRCN0000435133 TGATTCACAAACTGTTCTAAA pLKO_005 990 CDS 100% 13.200 9.240 N Acsm2 n/a
7 TRCN0000438597 GAGATTTCCTGCCGTACTTTC pLKO_005 163 CDS 100% 10.800 7.560 N Acsm2 n/a
8 TRCN0000429465 GGAAGGTGGAGTTCGTCTTAG pLKO_005 1757 CDS 100% 10.800 7.560 N Acsm2 n/a
9 TRCN0000112445 CCAGTGAGACTCCTGAGGCTT pLKO.1 1860 3UTR 100% 0.880 0.616 N Acsm2 n/a
10 TRCN0000112446 GCCAGTAAACAAACGGCCAAT pLKO.1 379 CDS 100% 4.050 2.430 N Acsm2 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4082 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001177978.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.