Transcript: Human NM_001184720.1

Homo sapiens glycogenin 1 (GYG1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
GYG1 (2992)
Length:
2000
CDS:
234..1235

Additional Resources:

NCBI RefSeq record:
NM_001184720.1
NBCI Gene record:
GYG1 (2992)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001184720.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116020 GCTGGTCGCTTACACAGTATT pLKO.1 499 CDS 100% 13.200 18.480 N GYG1 n/a
2 TRCN0000116019 CCAAGGCATACTGAACACATT pLKO.1 722 CDS 100% 4.950 6.930 N GYG1 n/a
3 TRCN0000116018 CCGTTTGTATCCTCGGAAGAA pLKO.1 1122 CDS 100% 4.950 6.930 N GYG1 n/a
4 TRCN0000116017 GCTGAGTGATTCATAAACATA pLKO.1 1723 3UTR 100% 5.625 3.938 N GYG1 n/a
5 TRCN0000116021 GCTGATTATATGGGAGCAGAT pLKO.1 1170 CDS 100% 4.050 2.835 N GYG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001184720.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13868 pDONR223 100% 99.8% None 14delC n/a
2 ccsbBroad304_13868 pLX_304 0% 99.8% V5 (not translated due to prior stop codon) 14delC n/a
Download CSV